About   Help   FAQ
D10Mit16 Primer Detail
Primers
  • Name
    D10Mit16
  • Primer 1 Sequence
    GGCATCAGCCAACGTACTCT
  • Primer 2 Sequence
    CGAATCCACACCCCTATGAG
  • ID
    MGI:701594
  • Product Size
    150
  • Other IDs
    D10Mit16 (BROAD)
  • Note
    MIT assay: A727
    Additional information: MIT STS Marker Data Files
Genes
D10Mit16 DNA segment, Chr 10, Massachusetts Institute of Technology 16
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit16 a 134bp CAST/EiJ
b 136bp AKR/J
c 144bp NON/ShiLt
d 146bp NOD/MrkTac
e 148bp A/J, BALB/cJ, LP/J
f 152bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J
g 200bp SPRET/EiJ
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D10Mit16 c upper CBA/Kw
e lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory