D10Mit12 Primer Detail MGI Mouse MGI:701598

D10Mit12 Primer Detail

Name

D10Mit12
Primer 1 Sequence

ATGTCCAAAACACCAGCCAG
Primer 2 Sequence

GGAAGTGATGGAGCTCTGTT
ID

MGI:701598
Product Size

240
Other IDs

D10Mit12 (BROAD)
Note

MIT assay: M172
Additional information: MIT STS Marker Data Files

D10Mit12

DNA segment, Chr 10, Massachusetts Institute of Technology 12

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit12	a	212bp	AKR/J, C3H/HeJ, NOD/MrkTac
	b	236bp	CAST/EiJ
	c	242bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit12	l	larger	LG/J
	D10Mit12	s	smaller	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit12	a	242bp	129/SvW, A.CA/W, BALB/cW, C57BL/6W, C57BL/10W, DBA/2W
	D10Mit12	b	212bp	AKR/W, BN/aW, C3H/W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24