DXMit22 Primer Detail MGI Mouse MGI:701646

DXMit22 Primer Detail

Name

DXMit22
Primer 1 Sequence

CCATGCTCACAGGCACAC
Primer 2 Sequence

CAGGCTGGGCTACAGAAGAC
ID

MGI:701646
Product Size

236
Other IDs

DXMit22 (BROAD)
Note

MIT assay: D585
Additional information: MIT STS Marker Data Files

DXMit22

DNA segment, Chr X, Massachusetts Institute of Technology 22

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	DXMit22	a	236bp	129X1/Sv
Not Specified	DXMit22	f	244bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit22	a	236bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, SPRET/EiJ
	b	244bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	c	264bp	CAST/EiJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit22	c	smaller	CBA/Kw
	DXMit22	e	larger	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24