DXMit21 Primer Detail MGI Mouse MGI:701647

DXMit21 Primer Detail

Name

DXMit21
Primer 1 Sequence

TGGGACAGAACCAACATCAA
Primer 2 Sequence

TCAGTTAGGCGCTGAAGGTT
ID

MGI:701647
Product Size

171
Other IDs

DXMit21 (BROAD)
Note

MIT assay: D543
Additional information: MIT STS Marker Data Files

DXMit21

DNA segment, Chr X, Massachusetts Institute of Technology 21

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit21	b	larger	C57BL/6J
	DXMit21	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit21	a	164bp	CAST/EiJ
	b	170bp	AKR/J, BALB/cJ
	c	174bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	d	182bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24