About   Help   FAQ
DXMit21 Primer Detail
Primers
  • Name
    DXMit21
  • Primer 1 Sequence
    TGGGACAGAACCAACATCAA
  • Primer 2 Sequence
    TCAGTTAGGCGCTGAAGGTT
  • ID
    MGI:701647
  • Product Size
    171
  • Other IDs
    DXMit21 (BROAD)
  • Note
    MIT assay: D543
    Additional information: MIT STS Marker Data Files
Genes
DXMit21 DNA segment, Chr X, Massachusetts Institute of Technology 21
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
DXMit21 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit21 a 164bp CAST/EiJ
b 170bp AKR/J, BALB/cJ
c 174bp A/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
d 182bp SPRET/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory