D16Mit42 Primer Detail MGI Mouse MGI:701672

D16Mit42 Primer Detail

Name

D16Mit42
Primer 1 Sequence

TAACCATCACATTCTTTTTCATGT
Primer 2 Sequence

TGTGGCATAAGGCAGGCT
ID

MGI:701672
Product Size

124
Other IDs

D16Mit42 (BROAD)
Note

MIT assay: MPC409
Additional information: MIT STS Marker Data Files

D16Mit42

DNA segment, Chr 16, Massachusetts Institute of Technology 42

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D16Mit42	m	132bp	MOLF/EiJ
Not Specified	D16Mit42	s	144bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit42	a	114bp	SPRET/EiJ
	b	128bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
	c	140bp	LP/J
	d	150bp	CAST/EiJ
	e	152bp	C3H/HeJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit42	a	152bp	C3H/W
	D16Mit42	b	114bp	129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W, CBA/W, DBA/2W

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24