About   Help   FAQ
D8Mit227 Primer Detail
Primers
  • Name
    D8Mit227
  • Primer 1 Sequence
    TCTAACCCATAGAGTCATCTCTTTAGC
  • Primer 2 Sequence
    GGGCACTTGAAAGAAAATTCC
  • ID
    MGI:701697
  • Product Size
    133
  • Other IDs
    D8Mit227 (BROAD)
  • Note
    MIT assay: MT3688
    Additional information: MIT STS Marker Data Files
Genes
D8Mit227 DNA segment, Chr 8, Massachusetts Institute of Technology 227
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit227 a 110bp CAST/EiJ
b 134bp A/J, AKR/J, BALB/cJ, LP/J, NOD/MrkTac, NON/ShiLt
c 136bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J
d 148bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit227 c 147bp CBA/CaOlaHsd
s 143bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/03/2024
MGI 6.24
The Jackson Laboratory