About   Help   FAQ
D6Mit294 Primer Detail
Primers
  • Name
    D6Mit294
  • Primer 1 Sequence
    TGGTACAGGGCACTGTCATC
  • Primer 2 Sequence
    CTTATGGCTACTGGGACCCA
  • ID
    MGI:701727
  • Product Size
    123
  • Other IDs
    D6Mit294 (BROAD)
  • Note
    MIT assay: MT5258
    Additional information: MIT STS Marker Data Files
Genes
D6Mit294 DNA segment, Chr 6, Massachusetts Institute of Technology 294
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit294 a 136bp 129X1/Sv
f 98, 132, 136bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit294 a 94bp SPRET/EiJ
b 98bp AKR/J, LP/J
c 122bp CAST/EiJ
d 126bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J
e 132bp A/J, BALB/cJ, NON/ShiLt
f 136bp NOD/MrkTac
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D6Mit294 a larger 129P3/J
s smaller SJL/J
J:156851 Golas A, MGI Direct Data Submission. 2010;
Endonuclease Gene Allele Fragments Strains
D6Mit294 b lower C57BL/6J
s upper 129/Sv
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory