About   Help   FAQ
D19Mit67 Primer Detail
Primers
  • Name
    D19Mit67
  • Primer 1 Sequence
    GAGAAAAGTTAGCATGCGTGG
  • Primer 2 Sequence
    TGGTAAGTAGGCTGTTAGATATGGC
  • ID
    MGI:701752
  • Product Size
    118
  • Other IDs
    D19Mit67 (BROAD)
  • Note
    MIT assay: D1133
    Additional information: MIT STS Marker Data Files
Genes
D19Mit67 DNA segment, Chr 19, Massachusetts Institute of Technology 67
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit67 m 156bp MOLF/EiJ
s 133bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit67 a 97bp SPRET/EiJ
b 113bp B6.Cg-Lepob/+, LP/J
c 115bp A/J, BALB/cJ, DBA/2J, NOD/MrkTac
d 129bp AKR/J, C3H/HeJ, CAST/EiJ, NON/ShiLt
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
11/12/2024
MGI 6.24 		The Jackson Laboratory