D12Mit49 Primer Detail MGI Mouse MGI:701757

D12Mit49 Primer Detail

Name

D12Mit49
Primer 1 Sequence

GGCCTCAGACCCAAGATGTA
Primer 2 Sequence

GTAAAGAAGGAATATCATGGGGC
ID

MGI:701757
Product Size

142
Other IDs

D12Mit49 (BROAD)
Note

MIT assay: Plex69
Additional information: MIT STS Marker Data Files

D12Mit49

DNA segment, Chr 12, Massachusetts Institute of Technology 49

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D12Mit49	a	123bp	129X1/Sv
Not Specified	D12Mit49	f	127bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit49	a	144bp	CAST/EiJ, DBA/2J, NOD/MrkTac
	b	146bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NON/ShiLt
	c	162bp	SPRET/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24