D13Mit153 Primer Detail MGI Mouse MGI:701767

D13Mit153 Primer Detail

Name

D13Mit153
Primer 1 Sequence

GCACGCCATCACGTAGTG
Primer 2 Sequence

TAACATTTTAAAAAACTGTGTCTGGG
ID

MGI:701767
Product Size

200
Other IDs

D13Mit153 (BROAD)
Note

MIT assay: MT1287
Additional information: MIT STS Marker Data Files

DNA segment, Chr 13, Massachusetts Institute of Technology 153

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit153	a	202bp	129X1/Sv
Not Specified	D13Mit153	f	202, 206, 210bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit153	a	196bp	A/J, BALB/cJ, NON/ShiLt
	b	198bp	NOD/MrkTac
	c	200bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J
	d	201bp	CAST/EiJ
	e	202bp	LP/J, SPRET/EiJ
	f	204bp	AKR/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24