D13Mit157 Primer Detail MGI Mouse MGI:701771

D13Mit157 Primer Detail

Name

D13Mit157
Primer 1 Sequence

ACACACCAGTTTGTTTTGTTCG
Primer 2 Sequence

AGCGTGGGAAAACACAGAAG
ID

MGI:701771
Product Size

142
Other IDs

D13Mit157 (BROAD)
Note

MIT assay: MT1321
Additional information: MIT STS Marker Data Files

DNA segment, Chr 13, Massachusetts Institute of Technology 157

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit157	a	119bp	SPRET/EiJ
	b	123bp	CAST/EiJ
	c	137bp	A/J, LP/J
	d	139bp	BALB/cJ, NOD/MrkTac, NON/ShiLt
	e	143bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J

J:61322 Montgomery JC, et al., MGI Direct Data Submission. 2000;

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit157	a	150bp	AEJ/Gn
	D13Mit157	s	119bp	M. spretus

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:61322 Montgomery JC, et al., Chromosomal localization of the mouse G protein-coupled receptor kinase 5 and 6 genes. MGI Direct Data Submission. 2000;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24