DXMit4 Primer Detail MGI Mouse MGI:701795

DXMit4 Primer Detail

Name

DXMit4
Primer 1 Sequence

TGGACAGTGCTTGAGGAATG
Primer 2 Sequence

GCAAAACAGCTACATTTGGG
ID

MGI:701795
Product Size

107
Other IDs

DXMit4 (BROAD)
Note

MIT assay: M118
Additional information: MIT STS Marker Data Files

DXMit4

DNA segment, Chr X, Massachusetts Institute of Technology 4

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	DXMit4	a	largest	C57BL/6, DBA/2
Not Specified	DXMit4	b	smaller	JF1, MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit4	a	100bp	CAST/EiJ
	b	102bp	SPRET/EiJ
	c	108bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24