About   Help   FAQ
D13Mit64 Primer Detail
Primers
  • Name
    D13Mit64
  • Primer 1 Sequence
    CCTCAGCACCAAAAAAGGAC
  • Primer 2 Sequence
    ACATCAGTGACCAGGCATCA
  • ID
    MGI:701807
  • Product Size
    103
  • Other IDs
    D13Mit64 (BROAD)
  • Note
    MIT assay: MPC932
    Additional information: MIT STS Marker Data Files
Genes
D13Mit64 DNA segment, Chr 13, Massachusetts Institute of Technology 64
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit64 a 102bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac
b 110bp A/J, BALB/cJ, LP/J, NON/ShiLt
c 112bp CAST/EiJ
d 116bp C3H/HeJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D13Mit64 c 113bp 129P3/J, A/JOlaHsd, BALB/cJ, SJL/J
d 105bp AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J
h 119bp C3H/HeJ
j 127bp JF1
p 107bp PWB
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D13Mit64 c larger CBA/Kw
e smaller KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory