D13Mit67 Primer Detail MGI Mouse MGI:701810

D13Mit67 Primer Detail

Name

D13Mit67
Primer 1 Sequence

TTTCATGGAGTCGAGTATTTTGG
Primer 2 Sequence

ATCTTGCATAGAACCTTTGGATG
ID

MGI:701810
Product Size

159
Other IDs

D13Mit67 (BROAD)
Note

MIT assay: MPC1370
Additional information: MIT STS Marker Data Files

DNA segment, Chr 10, Massachusetts Institute of Technology 1011

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit1011	a	140bp	A/J, BALB/cJ, LP/J, NOD/MrkTac
	b	142bp	CAST/EiJ
	c	152bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	160bp	C3H/HeJ, NON/ShiLt
	e	162bp	AKR/J, DBA/2J, SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D10Mit1011	a	166bp	AKR/OlaHsd
	b	160bp	C57BL/6JOlaHsd, JF1, SJL/J
	c	170bp	A/JOlaHsd, BALB/cJ
	d	168bp	DBA/2J
	g	154bp	129P3/J
	h	146bp	C3H/HeJ
	p	134bp	PWB
	r	150bp	C57BL/10

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24