D13Mit69 Primer Detail MGI Mouse MGI:701812

D13Mit69 Primer Detail

Name

D13Mit69
Primer 1 Sequence

AGCCAGCAACCAACATAACC
Primer 2 Sequence

ATTGCATCTAAGAAATGCACTACA
ID

MGI:701812
Product Size

199
Other IDs

D13Mit69 (BROAD)
Note

MIT assay: MPC1151
Additional information: MIT STS Marker Data Files

D13Mit69

DNA segment, Chr 13, Massachusetts Institute of Technology 69

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit69	a	172bp	129X1/Sv
Not Specified	D13Mit69	f	172, 198, 206bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit69	a	172bp	DBA/2J
	b	184bp	A/J
	c	198bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, LP/J, NON/ShiLt
	d	206bp	BALB/cJ, CAST/EiJ, NOD/MrkTac

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24