D19Mit106 Primer Detail MGI Mouse MGI:701814

D19Mit106 Primer Detail

Name

D19Mit106
Primer 1 Sequence

CCTTTTTTTTTTTAACCAGACAGG
Primer 2 Sequence

ATCAATGAATGAAGAACAAATAGTTTC
ID

MGI:701814
Product Size

124
Other IDs

D19Mit106 (BROAD)
Note

MIT assay: MTH560
Additional information: MIT STS Marker Data Files

DNA segment, Chr 19, Massachusetts Institute of Technology 106

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit106	a	124	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	128	129X1/SvJ
		c	122, 124bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit106	a	114bp	SPRET/EiJ
	b	116bp	C3H/HeJ, DBA/2J, NON/ShiLt
	c	122bp	AKR/J
	d	124bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac
	e	128bp	CAST/EiJ
	f	134bp	A/J, BALB/cJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit106	c	smaller	CBA/Kw
	D19Mit106	e	larger	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24