D6Mit52 Primer Detail MGI Mouse MGI:701843

D6Mit52 Primer Detail

Name

D6Mit52
Primer 1 Sequence

TAAGTCAGCCCAAGGAAGTCA
Primer 2 Sequence

AAGGCACCTATATTTGTGCACA
ID

MGI:701843
Product Size

144
Other IDs

D6Mit52 (BROAD)
Note

MIT assay: B681
Additional information: MIT STS Marker Data Files

D6Mit52

DNA segment, Chr 6, Massachusetts Institute of Technology 52

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit52	a	126bp	NOD/MrkTac
	b	142bp	A/J, AKR/J, C3H/HeJ, CAST/EiJ, DBA/2J, LP/J
	c	144bp	BALB/cJ
	d	146bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D6Mit52	b	142bp	C57BL/6JOlaHsd
	d	138bp	129P3/J, AKR/OlaHsd, BALB/cJ, C3H/HeJ, DBA/2J
	j	144bp	JF1
	l	122bp	SJL/J
	p	140bp	C57BL/10, PWB
	w	134bp	A/JOlaHsd

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24