D6Mit254 Primer Detail MGI Mouse MGI:701853

D6Mit254 Primer Detail

Name

D6Mit254
Primer 1 Sequence

AGTGTCCCTAGGGGGTGG
Primer 2 Sequence

GGGGCCTTAGAGGTAGCAAC
ID

MGI:701853
Product Size

118
Other IDs

D6Mit254 (BROAD)
Note

MIT assay: D1227
Additional information: MIT STS Marker Data Files

D6Mit254

DNA segment, Chr 6, Massachusetts Institute of Technology 254

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit254	a	97bp	SPRET/EiJ
	b	117bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	139bp	B6.Cg-Lep^ob/+, C57BL/6J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit254	a	139bp	129/SvW, C57BL/6W, C57BL/10W
	D6Mit254	b	117bp	A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24