D12Mit236 Primer Detail MGI Mouse MGI:701861

D12Mit236 Primer Detail

Name

D12Mit236
Primer 1 Sequence

TGTTGCTAATCACAGTCCATATCC
Primer 2 Sequence

GTTGGCTTCTGGCTTCTGAC
ID

MGI:701861
Product Size

121
Other IDs

D12Mit236 (BROAD)
Note

MIT assay: MTH536
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 236

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit236	a	109bp	A/J, AKR/J, BALB/cJ, C3H/HeJ
	b	121bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	123bp	SPRET/EiJ
	d	129bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D12Mit236	a	124bp	BN/aW
	b	121bp	129/SvW, C57BL/6W, C57BL/10W, DBA/2W
	c	109bp	A.CA/W, AKR/W, BALB/cW, C3H/W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24