About   Help   FAQ
D3Mit77 Primer Detail
Primers
  • Name
    D3Mit77
  • Primer 1 Sequence
    TCCTGCTGACACCACCAAG
  • Primer 2 Sequence
    AGCACCTACATTTTCCGCAA
  • ID
    MGI:701899
  • Product Size
    150
  • Other IDs
    D3Mit77 (BROAD)
  • Note
    MIT assay: MPC1744
    Additional information: MIT STS Marker Data Files
Genes
D3Mit77 DNA segment, Chr 3, Massachusetts Institute of Technology 77
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit77 a 150bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J
b 164bp A/J, BALB/cJ, C3H/HeJ
c 166bp NOD/MrkTac
d 168bp NON/ShiLt
e 170bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D3Mit77 c 151bp 129P3/J, AKR/OlaHsd, BALB/cJ, C57BL/6JOlaHsd, C57BL/10, SJL/J
d 147bp DBA/2J
h 169bp C3H/HeJ
j 157bp JF1
p 127bp PWB
w 165bp A/JOlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory