About   Help   FAQ
D17Mit180 Primer Detail
Primers
  • Name
    D17Mit180
  • Primer 1 Sequence
    AGACACTGTCTAAAAACACAAGATGG
  • Primer 2 Sequence
    TTGTGTTCATATGCATGTGTGC
  • ID
    MGI:701903
  • Product Size
    144
  • Other IDs
    D17Mit180 (BROAD)
  • Note
    MIT assay: MT3515
    Additional information: MIT STS Marker Data Files
Genes
D17Mit180 DNA segment, Chr 17, Massachusetts Institute of Technology 180
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D17Mit180 c 150bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit180 a 134bp NON/ShiLt
b 140bp SPRET/EiJ
c 148bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac
d 150bp A/J, BALB/cJ, C3H/HeJ, LP/J
e 158bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D17Mit180 b 136bp C57BL/6JOlaHsd, C57BL/10, JF1
d 138bp A/JOlaHsd, AKR/OlaHsd, BALB/cJ, C3H/HeJ, DBA/2J
g 140bp 129P3/J, SJL/J
p 132bp PWB
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit180 c 135bp CBA/CaOlaHsd
s 132bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory