D9Mit205 Primer Detail MGI Mouse MGI:701918

D9Mit205 Primer Detail

Name

D9Mit205
Primer 1 Sequence

AATAGCCTACTCTGGATTCACAGG
Primer 2 Sequence

TACCTTCTCCTCTTTGGTTTTTG
ID

MGI:701918
Product Size

191
Other IDs

D9Mit205 (BROAD)
Note

MIT assay: MT3241
Additional information: MIT STS Marker Data Files

D9Mit205

DNA segment, Chr 9, Massachusetts Institute of Technology 205

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D9Mit205	a	190bp	129X1/Sv
Not Specified	D9Mit205	f	180bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit205	c	198bp	C3HeB/FeJLe
	D9Mit205	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit205	a	172bp	CAST/EiJ
	b	180bp	NOD/MrkTac, NON/ShiLt
	c	186bp	SPRET/EiJ
	d	190bp	LP/J
	e	194bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	198bp	A/J, BALB/cJ, C3H/HeJ
	g	202bp	AKR/J, DBA/2J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit205	c	131bp	CBA/CaOlaHsd
	D9Mit205	s	155bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24