D2Mit323 Primer Detail MGI Mouse MGI:701946

D2Mit323 Primer Detail

Name

D2Mit323
Primer 1 Sequence

AGAATCCTAAGTGGTGGTTAGAGG
Primer 2 Sequence

ACCCAAAGTTGTCTTTAAGTACACA
ID

MGI:701946
Product Size

125
Other IDs

D2Mit323 (BROAD)
Note

MIT assay: MTAR4040
Additional information: MIT STS Marker Data Files

D2Mit323

DNA segment, Chr 2, Massachusetts Institute of Technology 323

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit323	c	110bp	C3HeB/FeJLe
	D2Mit323	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit323	a	110bp	C3H/HeJ
	b	114bp	SPRET/EiJ
	c	126bp	A/J, AKR/J, DBA/2J, NOD/MrkTac, NON/ShiLt
	d	128bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J
	e	134bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit323	c	200bp	CBA/CaOlaHsd
	D2Mit323	s	206bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24