D18Mit39 Primer Detail MGI Mouse MGI:701993

D18Mit39 Primer Detail

Name

D18Mit39
Primer 1 Sequence

ATACAAATGGCTGAGAAATACACA
Primer 2 Sequence

TCCCACCAGCAGTGAATACA
ID

MGI:701993
Product Size

224
Other IDs

D18Mit39 (BROAD)
Note

MIT assay: B519
Additional information: MIT STS Marker Data Files

D18Mit39

DNA segment, Chr 18, Massachusetts Institute of Technology 39

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D18Mit39	m	260bp	MOLF/EiJ
Not Specified	D18Mit39	s	250bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit39	a	222bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J
	b	224bp	A/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, NON/ShiLt
	c	226bp	LP/J
	d	234bp	SPRET/EiJ

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24