D4Mit149 Primer Detail MGI Mouse MGI:702001

D4Mit149 Primer Detail

Name

D4Mit149
Primer 1 Sequence

TGAATTCAGAAGGATGTGTGTATG
Primer 2 Sequence

ATGTGAGAATCAACACCTGAGG
ID

MGI:702001
Product Size

111
Other IDs

D4Mit149 (BROAD)
Note

MIT assay: MMH335
Additional information: MIT STS Marker Data Files

D4Mit149

DNA segment, Chr 4, Massachusetts Institute of Technology 149

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit149	c	130bp	C3HeB/FeJLe
	D4Mit149	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit149	a	114bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
	b	122bp	A/J
	c	126bp	CAST/EiJ
	d	130bp	BALB/cJ, C3H/HeJ, DBA/2J, LP/J
	e	144bp	SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit149	c	157bp	CBA/CaOlaHsd
	D4Mit149	s	145bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D4Mit149	a	130bp	BALB/cW, C3H/W, CBA/W, DBA/2W
	b	122bp	A.CA/W
	c	114bp	129/SvW, AKR/W, BN/aW, C57BL/6W, C57BL/10W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24