D4Mit148 Primer Detail MGI Mouse MGI:702002

D4Mit148 Primer Detail

Name

D4Mit148
Primer 1 Sequence

CCAAGGAACAACACTTAAAGTGG
Primer 2 Sequence

TACGCACATGTCTGCATGG
ID

MGI:702002
Product Size

128
Other IDs

D4Mit148 (BROAD)
Note

MIT assay: MT173
Additional information: MIT STS Marker Data Files

D4Mit148

DNA segment, Chr 4, Massachusetts Institute of Technology 148

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit148	b	smaller	C57BL/6J
	D4Mit148	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit148	a	128bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	b	140bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
	c	150bp	SPRET/EiJ
	d	154bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13