D11Mit28 Primer Detail MGI Mouse MGI:702037

D11Mit28 Primer Detail

Name

D11Mit28
Primer 1 Sequence

TGGGAAGCTGGGTGTTTTTA
Primer 2 Sequence

GAAAGCTGCCCTCTGACATC
ID

MGI:702037
Product Size

149
Other IDs

D11Mit28 (BROAD)
Note

MIT assay: B421
Additional information: MIT STS Marker Data Files

D11Mit28

DNA segment, Chr 11, Massachusetts Institute of Technology 28

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit28	a	largest	C57BL/6
		b	smaller	DBA/2, JF1
		c	smallest	MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit28	a	122bp	NON/ShiLt
	b	148bp	BALB/cJ, C3H/HeJ, DBA/2J
	c	152bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac
	d	154bp	AKR/J, SPRET/EiJ
	e	158bp	CAST/EiJ

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24