D16Mit110 Primer Detail MGI Mouse MGI:702069

D16Mit110 Primer Detail

Name

D16Mit110
Primer 1 Sequence

CAGAGAATCCCCACCTTGAA
Primer 2 Sequence

GGTACCATGGATATCAAGTATGAGC
ID

MGI:702069
Product Size

94
Other IDs

D16Mit110 (BROAD)
Note

MIT assay: MT2302
Additional information: MIT STS Marker Data Files

DNA segment, Chr 16, Massachusetts Institute of Technology 110

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit110	a	90bp	C57BL/6J, DBA/2J
	b	92bp	SPRET/EiJ
	c	94bp	B6.Cg-Lep^ob/+, C3H/HeJ, LP/J
	d	100bp	A/J, BALB/cJ, CAST/EiJ, NON/ShiLt
	e	102bp	NOD/MrkTac
	f	112bp	AKR/J

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit110	c	smaller	CBA/Kw
	D16Mit110	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24