D1Mit102 Primer Detail MGI Mouse MGI:702096

D1Mit102 Primer Detail

Name

D1Mit102
Primer 1 Sequence

AAATACCAGCAAAACAATAAAGGC
Primer 2 Sequence

TGAATTAAAATTGCAGAGGCG
ID

MGI:702096
Product Size

113
Other IDs

D1Mit102 (BROAD)
Note

MIT assay: MPC1040
Additional information: MIT STS Marker Data Files

D1Mit102

DNA segment, Chr 1, Massachusetts Institute of Technology 102

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D1Mit102	a	116bp	129X1/Sv
Not Specified	D1Mit102	f	120, 122bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit102	b	smaller	C57BL/6J
	D1Mit102	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit102	a	112bp	BALB/cJ
	b	116bp	AKR/J, DBA/2J, LP/J
	c	120bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	122bp	NOD/MrkTac
	e	126bp	CAST/EiJ, SPRET/EiJ
	f	128bp	A/J, C3H/HeJ, NON/ShiLt

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit102	c	120bp	CBA/CaOlaHsd
	D1Mit102	s	110bp	SWR/OlaHsd

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit102	a	larger	129P3/J
	D1Mit102	s	smaller	SJL/J

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit102	c	upper	CBA/Kw
	D1Mit102	e	lower	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/03/2024 MGI 6.24