DXMit172 Primer Detail MGI Mouse MGI:702103

DXMit172 Primer Detail

Name

DXMit172
Primer 1 Sequence

TACCACAGTTTGAATAAAGATGTGTG
Primer 2 Sequence

GAAGAAACCATGACTCCTCTTTG
ID

MGI:702103
Product Size

148
Other IDs

DXMit172 (BROAD)
Note

MIT assay: MT4395
Additional information: MIT STS Marker Data Files

DXMit172

DNA segment, Chr X, Massachusetts Institute of Technology 172

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit172	a	134bp	A/J, BALB/cJ, C3H/HeJ
	b	138bp	SPRET/EiJ
	c	146bp	CAST/EiJ
	d	148bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
DXMit172	c	129bp	A/JOlaHsd, BALB/cJ, C3H/HeJ, JF1
	d	147bp	129P3/J, AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J, SJL/J
	p	137bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24