D7Mit74 Primer Detail MGI Mouse MGI:702120

D7Mit74 Primer Detail

Name

D7Mit74
Primer 1 Sequence

GACCACCACTGCCTGTTTTT
Primer 2 Sequence

GGTTGGGCTGTGCATAGG
ID

MGI:702120
Product Size

115
Note

MIT assay: MPC1510

D7Mit74a	DNA segment, Chr 7, Massachusetts Institute of Technology 74a
D7Mit74b	DNA segment, Chr 7, Massachusetts Institute of Technology 74b

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit74a	m	115bp	MOLF/EiJ
Not Specified	D7Mit74a	s	121bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit74a	a	112bp	NON/ShiLt
	b	116bp	A/J, BALB/cJ, NOD/MrkTac
	c	118bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
	d	128bp	SPRET/EiJ
	e	130bp	AKR/J
	f	132bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D7Mit74a	c	112bp	CBA/CaOlaHsd
	D7Mit74a	s	106bp	SWR/OlaHsd

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24