D5Mit48 Primer Detail MGI Mouse MGI:702123

D5Mit48 Primer Detail

Name

D5Mit48
Primer 1 Sequence

GACTATCATCCAAGCCAAGACC
Primer 2 Sequence

AAAAGACACTTTCCCTGACATAGC
ID

MGI:702123
Product Size

199
Other IDs

D5Mit48 (BROAD)
Note

MIT assay: D653
Additional information: MIT STS Marker Data Files

D5Mit48

DNA segment, Chr 5, Massachusetts Institute of Technology 48

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D5Mit48	b	larger than f	C57BL/6J
	c	206bp	C3HeB/FeJLe
	f	smaller than c and b	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit48	a	150bp	NOD/MrkTac, SPRET/EiJ
	b	194bp	LP/J
	c	198bp	BALB/cJ
	d	202bp	NON/ShiLt
	e	206bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J
	f	208bp	AKR/J
	g	210bp	DBA/2J
	h	230bp	CAST/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit48	l	larger	LG/J
	D5Mit48	s	smaller	SM/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit48	c	202bp	CBA/CaOlaHsd
	D5Mit48	s	199bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24