D13Mit110 Primer Detail MGI Mouse MGI:702202

D13Mit110 Primer Detail

Name

D13Mit110
Primer 1 Sequence

ACAGAGAGCGTCCATGTGC
Primer 2 Sequence

TGTAAAGCTCCACCCACTCC
ID

MGI:702202
Product Size

161
Note

MIT assay: MPC1044

DNA segment, Chr 13, Massachusetts Institute of Technology 110

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit110	a	162bp	129X1/Sv
Not Specified	D13Mit110	f	158, 162bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit110	a	154bp	A/J
	b	158bp	C3H/HeJ, LP/J, NON/ShiLt
	c	160bp	AKR/J
	d	162bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac
	e	166bp	DBA/2J
	f	170bp	SPRET/EiJ
	g	176bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit110	c	131bp	CBA/CaOlaHsd
	D13Mit110	s	130bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24