D8Mit51 Primer Detail MGI Mouse MGI:702240

D8Mit51 Primer Detail

Name

D8Mit51
Primer 1 Sequence

TTTCGACATTGTGTGAGATTCC
Primer 2 Sequence

ATGAAACATATGTGAGAATGTCCA
ID

MGI:702240
Product Size

213
Other IDs

D8Mit51 (BROAD)
Note

MIT assay: B539
Additional information: MIT STS Marker Data Files

D8Mit51

DNA segment, Chr 8, Massachusetts Institute of Technology 51

J:47553 Bartsch JW, et al., Genomics. 1998 Apr 1;49(1):129-32

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D8Mit51	b	0.212kb	C57BL/6J
Not Specified	D8Mit51	s	0.19kb	SEG/1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit51	a	190bp	SPRET/EiJ
	b	208bp	DBA/2J
	c	212bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, NON/ShiLt
	d	220bp	AKR/J, BALB/cJ, LP/J, NOD/MrkTac
	e	226bp	CAST/EiJ

J:47553 Bartsch JW, et al., The protein kinase N (PKN) gene PRKCL1/Prkcl1 maps to human chromosome 19p12-p13.1 and mouse chromosome 8 with close linkage to the myodystrophy (myd) mutation. Genomics. 1998 Apr 1;49(1):129-32

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24