D9Mit129 Primer Detail MGI Mouse MGI:702241

D9Mit129 Primer Detail

Name

D9Mit129
Primer 1 Sequence

TTGTCTTTTAACCTCCTGGAGC
Primer 2 Sequence

TCCCATCTTTCTCCTTGTGG
ID

MGI:702241
Product Size

132
Other IDs

D9Mit129 (BROAD)
Note

MIT assay: MT185
Additional information: MIT STS Marker Data Files

D9Mit129

DNA segment, Chr 9, Massachusetts Institute of Technology 129

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit129	a	132bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	150bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, SPRET/EiJ
	c	156bp	CAST/EiJ
	d	160bp	AKR/J, NON/ShiLt

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit129	l	smaller	LG/J
	D9Mit129	s	larger	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D9Mit129	a	160bp	AKR/W
	b	150bp	129/SvW, AKR/W, DBA/2W
	c	136bp	BN/aW
	d	132bp	C57BL/6W, C57BL/10W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24