About   Help   FAQ
D18Mit60 Primer Detail
Primers
  • Name
    D18Mit60
  • Primer 1 Sequence
    ACCTGACACCATTTTCAGGC
  • Primer 2 Sequence
    ATCCTTGAGCCTGTTAAAAGACA
  • ID
    MGI:702260
  • Product Size
    205
  • Other IDs
    D18Mit60 (BROAD)
  • Note
    MIT assay: MPC1605
    Additional information: MIT STS Marker Data Files
Genes
D18Mit60 DNA segment, Chr 18, Massachusetts Institute of Technology 60
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D18Mit60 C 174bp C3HeB/FeJLe
f larger FVB/N
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D18Mit60 m 246bp MOLF/EiJ
s 238bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit60 a 174bp C3H/HeJ, CAST/EiJ
b 176bp BALB/cJ
c 180bp AKR/J, LP/J, NON/ShiLt
d 184bp SPRET/EiJ
e 186bp B6.Cg-Lepob/+, C57BL/6J
f 188bp NOD/MrkTac
g 194bp A/J, DBA/2J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D18Mit60 b 207bp C57BL/6JOlaHsd, C57BL/10
c 191bp BALB/cJ, C3H/HeJ
d 215bp A/JOlaHsd, DBA/2J
j 203bp JF1
p 199bp 129P3/J, AKR/OlaHsd, PWB, SJL/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D18Mit60 c 212bp CBA/CaOlaHsd
s 198bp SWR/OlaHsd
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D18Mit60 c larger CBA/Kw
e smaller KE
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory