About   Help   FAQ
D1Mit332 Primer Detail
Primers
  • Name
    D1Mit332
  • Primer 1 Sequence
    CATCTGAAGAAAATGAAGAACGG
  • Primer 2 Sequence
    GCCAGCACAGAAAAAGAATAGC
  • ID
    MGI:702267
  • Product Size
    121
  • Other IDs
    D1Mit332 (BROAD)
  • Note
    MIT assay: MT4184
    Additional information: MIT STS Marker Data Files
Genes
D1Mit332 DNA segment, Chr 1, Massachusetts Institute of Technology 332
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit332 a 98bp CAST/EiJ
b 110bp AKR/J, LP/J, NON/ShiLt
c 112bp SPRET/EiJ
d 118bp A/J, BALB/cJ, C3H/HeJ, NOD/MrkTac
e 122bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D1Mit332 a 110bp 129P3/J, AKR/OlaHsd
c 118bp A/JOlaHsd, BALB/cJ, C3H/HeJ
d 122bp C57BL/6JOlaHsd, C57BL/10, DBA/2J, SJL/J
j 98bp JF1
p 104bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory