D1Mit332 Primer Detail MGI Mouse MGI:702267

D1Mit332 Primer Detail

Name

D1Mit332
Primer 1 Sequence

CATCTGAAGAAAATGAAGAACGG
Primer 2 Sequence

GCCAGCACAGAAAAAGAATAGC
ID

MGI:702267
Product Size

121
Other IDs

D1Mit332 (BROAD)
Note

MIT assay: MT4184
Additional information: MIT STS Marker Data Files

D1Mit332

DNA segment, Chr 1, Massachusetts Institute of Technology 332

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit332	a	98bp	CAST/EiJ
	b	110bp	AKR/J, LP/J, NON/ShiLt
	c	112bp	SPRET/EiJ
	d	118bp	A/J, BALB/cJ, C3H/HeJ, NOD/MrkTac
	e	122bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D1Mit332	a	110bp	129P3/J, AKR/OlaHsd
	c	118bp	A/JOlaHsd, BALB/cJ, C3H/HeJ
	d	122bp	C57BL/6JOlaHsd, C57BL/10, DBA/2J, SJL/J
	j	98bp	JF1
	p	104bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24