About   Help   FAQ
D15Mit188 Primer Detail
Primers
  • Name
    D15Mit188
  • Primer 1 Sequence
    TTCACTCCAAATCCTCCGAC
  • Primer 2 Sequence
    GAAGAGGAAATGCAAGCCAG
  • ID
    MGI:702292
  • Product Size
    137
  • Other IDs
    D15Mit188 (BROAD)
  • Note
    MIT assay: MT2888
    Additional information: MIT STS Marker Data Files
Genes
D15Mit188a DNA segment, Chr 15, Massachusetts Institute of Technology 188a
D15Mit188b DNA segment, Chr 15, Massachusetts Institute of Technology 188b
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit188a a 148bp CAST/EiJ
b 158bp SPRET/EiJ
c 163bp C57BL/6J
d 182bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D15Mit188a c 139bp CBA/CaOlaHsd
s 134bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory