About   Help   FAQ
D18Mit35 Primer Detail
Primers
  • Name
    D18Mit35
  • Primer 1 Sequence
    TTCATCTACACTGGTTAGACAGCA
  • Primer 2 Sequence
    CAATGCTGGGAGAGTGGG
  • ID
    MGI:702294
  • Product Size
    142
  • Other IDs
    D18Mit35 (BROAD)
  • Note
    MIT assay: B397
    Additional information: MIT STS Marker Data Files
Genes
D18Mit35 DNA segment, Chr 18, Massachusetts Institute of Technology 35
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D18Mit35 m 158bp MOLF/EiJ
s 146bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit35 a 132bp NON/ShiLt
b 136bp C57BL/6J
c 138bp B6.Cg-Lepob/+
d 142bp A/J
e 144bp AKR/J
f 146bp BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac
g 150bp CAST/EiJ
h 158bp SPRET/EiJ
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/17/2024
MGI 6.24 		The Jackson Laboratory