D13Mit211 Primer Detail MGI Mouse MGI:702315

D13Mit211 Primer Detail

Name

D13Mit211
Primer 1 Sequence

TTTGCAAAAGACAAGACTTATTGC
Primer 2 Sequence

AAAAGACATCCAGTTCTCAATGG
ID

MGI:702315
Product Size

114
Other IDs

D13Mit211 (BROAD)
Note

MIT assay: MT3323
Additional information: MIT STS Marker Data Files

DNA segment, Chr 13, Massachusetts Institute of Technology 211

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit211	a	118bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NON/ShiLt
	b	130bp	C3H/HeJ
	c	144bp	SPRET/EiJ
	d	162bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D13Mit211	a	130bp	C3H/W
	b	126bp	CBA/W
	c	118bp	129/SvW, BALB/cW, BN/aW, C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24