D6Mit105 Primer Detail MGI Mouse MGI:702316

D6Mit105 Primer Detail

Name

D6Mit105
Primer 1 Sequence

CTGTCTCCACTACTTCTATTCCTGG
Primer 2 Sequence

CAAAAGCCTTATATATTACACCTCACC
ID

MGI:702316
Product Size

237
Other IDs

D6Mit105 (BROAD)
Note

MIT assay: MPC1203
Additional information: MIT STS Marker Data Files

D6Mit105

DNA segment, Chr 6, Massachusetts Institute of Technology 105

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Mit105	a	234bp	129X1/Sv
Not Specified	D6Mit105	f	222, 234bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit105	a	208bp	SPRET/EiJ
	b	214bp	CAST/EiJ, NON/ShiLt
	c	218bp	DBA/2J
	d	220bp	A/J
	e	222bp	AKR/J, BALB/cJ, C3H/HeJ, LP/J
	f	234bp	B6.Cg-Lep^ob/+, C57BL/6J
	g	238bp	NOD/MrkTac

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D6Mit105	a	225bp	129P3/J, A/JOlaHsd, AKR/OlaHsd, C3H/HeJ
	b	235bp	C57BL/6JOlaHsd, C57BL/10
	c	223bp	BALB/cJ
	d	219bp	DBA/2J, JF1, PWB
	l	211bp	SJL/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24