D12Mit99 Primer Detail MGI Mouse MGI:702324

D12Mit99 Primer Detail

Name

D12Mit99
Primer 1 Sequence

CTTACAGAAAATGAAAACCAAAACA
Primer 2 Sequence

CCTCTGCTTTAGAGGCAAACG
ID

MGI:702324
Product Size

151
Other IDs

D12Mit99 (BROAD)
Note

MIT assay: MPC2219
Additional information: MIT STS Marker Data Files

D12Mit99

DNA segment, Chr 12, Massachusetts Institute of Technology 99

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D12Mit99	a	173bp	129X1/Sv
Not Specified	D12Mit99	f	151bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit99	a	147bp	SPRET/EiJ
	b	151bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	c	153bp	CAST/EiJ
	d	173bp	AKR/J, BALB/cJ, DBA/2J, LP/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24