D6Mit10 Primer Detail MGI Mouse MGI:702333

D6Mit10 Primer Detail

Name

D6Mit10
Primer 1 Sequence

TCAGAGGAACAAAGCAGCAT
Primer 2 Sequence

CCTGTGGCTAACAGGTAAAA
ID

MGI:702333
Product Size

200
Other IDs

D6Mit10 (BROAD)
Note

MIT assay: M78
Additional information: MIT STS Marker Data Files

D6Mit10

DNA segment, Chr 6, Massachusetts Institute of Technology 10

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Mit10	a	191bp	129X1/Sv
Not Specified	D6Mit10	f	198bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit10	a	191bp	C3H/HeJ, NOD/MrkTac
	b	198bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J
	c	206bp	DBA/2J
	d	207bp	NON/ShiLt
	e	210bp	CAST/EiJ
	f	212bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D6Mit10	a	206bp	129/SvW, A.CA/W, BALB/cW, BN/aW, CBA/W, DBA/2W
	b	198bp	AKR/W, C57BL/6W, C57BL/10W
	c	191bp	C3H/W

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24