About   Help   FAQ
D6Mit15 Primer Detail
Primers
  • Name
    D6Mit15
  • Primer 1 Sequence
    CACTGACCCTAGCACAGCAG
  • Primer 2 Sequence
    TCCTGGCTTCCACAGGTACT
  • ID
    MGI:702338
  • Product Size
    253
  • Other IDs
    D6Mit15 (BROAD)
  • Note
    MIT assay: M148
    Additional information: MIT STS Marker Data Files
Genes
D6Mit15 DNA segment, Chr 6, Massachusetts Institute of Technology 15
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit15 a 195bp 129X1/Sv
f 150, 160bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D6Mit15 c 195bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit15 a 150bp NOD/MrkTac
b 195bp A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
c 220bp CAST/EiJ
d 260bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt, SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D6Mit15 c largest C58/J
f not given FVB/NJ
i larger I/LnJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D6Mit15 l larger LG/J
s smaller SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D6Mit15 a 260bp AKR/W, C57BL/6W, C57BL/10W
b 195bp A.CA/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W
c 170bp 129/SvW
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory