D11Mit156 Primer Detail MGI Mouse MGI:702347

D11Mit156 Primer Detail

Name

D11Mit156
Primer 1 Sequence

CCCTGCCCTGAGTGTCTCT
Primer 2 Sequence

GAGGGACAGTGAGTGTCAAGC
ID

MGI:702347
Product Size

111
Other IDs

D11Mit156 (BROAD)
Note

MIT assay: MT556
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 156

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit156	a	117bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, SPRET/EiJ
	b	119bp	AKR/J, CAST/EiJ, NOD/MrkTac, NON/ShiLt
	c	121bp	BALB/cJ
	d	125bp	A/J, C3H/HeJ

J:156851 Golas A, MGI Direct Data Submission. 2010;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit156	b	upper	C57BL/6J
	D11Mit156	s	lower	129/Sv

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24