D3Mit268 Primer Detail MGI Mouse MGI:702356

D3Mit268 Primer Detail

Name

D3Mit268
Primer 1 Sequence

GGGATTTTAAAGCAAAGCCC
Primer 2 Sequence

TCATGCACACACATGAACATG
ID

MGI:702356
Product Size

103
Other IDs

D3Mit268 (BROAD)
Note

MIT assay: MT3545
Additional information: MIT STS Marker Data Files

D3Mit268

DNA segment, Chr 3, Massachusetts Institute of Technology 268

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit268	a	106bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	b	118bp	SPRET/EiJ
	c	122bp	A/J, C3H/HeJ, CAST/EiJ, DBA/2J
	d	130bp	AKR/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D3Mit268	a	130bp	AKR/W
	b	122bp	A.CA/W, C3H/W, CBA/W, DBA/2W
	c	112bp	BN/aW
	d	106bp	129/SvW, BALB/cW, C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24