D9Mit248 Primer Detail MGI Mouse MGI:702380

D9Mit248 Primer Detail

Name

D9Mit248
Primer 1 Sequence

TCAGAGTTCAGGAGGGCTGT
Primer 2 Sequence

TCTGAGAGGCCACATGTCTG
ID

MGI:702380
Product Size

130
Other IDs

D9Mit248 (BROAD)
Note

MIT assay: MT3629
Additional information: MIT STS Marker Data Files

D9Mit248

DNA segment, Chr 9, Massachusetts Institute of Technology 248

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit248	c	132bp	C3HeB/FeJLe
	D9Mit248	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit248	a	108bp	SPRET/EiJ
	b	122bp	AKR/J, DBA/2J, NOD/MrkTac
	c	130bp	B6.Cg-Lep^ob/+
	d	132bp	A/J, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NON/ShiLt
	e	152bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit248	c	118bp	CBA/CaOlaHsd
	D9Mit248	s	119bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24