About   Help   FAQ
D4Mit190 Primer Detail
Primers
  • Name
    D4Mit190
  • Primer 1 Sequence
    CAGTGAAGCAAAAAGATTCGG
  • Primer 2 Sequence
    TTCCAGTCTTGGGAATGTATCC
  • ID
    MGI:702381
  • Product Size
    144
  • Other IDs
    D4Mit190 (BROAD)
  • Note
    MIT assay: MT1660
    Additional information: MIT STS Marker Data Files
Genes
D4Mit190 DNA segment, Chr 4, Massachusetts Institute of Technology 190
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D4Mit190 c 121bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit190 a 121bp AKR/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt
b 133bp SPRET/EiJ
c 145bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
d 151bp DBA/2J, LP/J
e 171bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit190 c 145bp CBA/CaOlaHsd
s 146bp SWR/OlaHsd
J:68682 Li X, et al., Mamm Genome. 2001 Jan;12(1):13-6
Endonuclease Gene Allele Fragments Strains
D4Mit190 a bigger C57BL/6ByJ
b smaller 129P3/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:68682 Li X, et al., High-resolution genetic mapping of the saccharin preference locus (Sac) and the putative sweet taste receptor (T1R1) gene (Gpr70) to mouse distal Chromosome 4. Mamm Genome. 2001 Jan;12(1):13-6
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory