D10Mit96 Primer Detail MGI Mouse MGI:702435

D10Mit96 Primer Detail

Name

D10Mit96
Primer 1 Sequence

CTTCTTTGAAGTTAGATGCAGCC
Primer 2 Sequence

TACGGAGAAGGGAACACCTG
ID

MGI:702435
Product Size

150
Other IDs

D10Mit96 (BROAD)
Note

MIT assay: MPC2327
Additional information: MIT STS Marker Data Files

D10Mit96

DNA segment, Chr 10, Massachusetts Institute of Technology 96

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit96	a	127bp	C3H/HeJ, NOD/MrkTac
	b	149bp	AKR/J
	c	153bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
	d	155bp	A/J
	e	165bp	SPRET/EiJ
	f	171bp	CAST/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit96	l	smaller	LG/J
	D10Mit96	s	larger	SM/J

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit96	e	lower	KE
	D10Mit96	k	upper	CBA/Kw

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24