D3Mit127 Primer Detail MGI Mouse MGI:702440

D3Mit127 Primer Detail

Name

D3Mit127
Primer 1 Sequence

CCTTCTGACAAGCAGGATTTG
Primer 2 Sequence

TTTCTAGCATCTCCAAGCAGG
ID

MGI:702440
Product Size

175
Other IDs

D3Mit127 (BROAD)
Note

MIT assay: MT177
Additional information: MIT STS Marker Data Files

D3Mit127

DNA segment, Chr 3, Massachusetts Institute of Technology 127

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit127	a	106bp	CAST/EiJ
	b	132bp	DBA/2J
	c	168bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J, NON/ShiLt
	d	176bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	188bp	SPRET/EiJ
	f	240bp	NOD/MrkTac

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit127	a	larger	129P3/J
	D3Mit127	s	smaller	SJL/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D3Mit127	a	262bp	CBA/W
	b	176bp	C57BL/6W, C57BL/10W
	c	168bp	129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W
	d	132bp	DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/09/2024 MGI 6.24